Review



restriction enzyme bbsi  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98

    Structured Review

    New England Biolabs restriction enzyme bbsi
    Restriction Enzyme Bbsi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1914 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bbsi/BbsI/pmc13095346-38-12-20
    Average 98 stars, based on 1914 article reviews
    restriction enzyme bbsi - by Bioz Stars, 2026-09
    98/100 stars

    Images

    Related Articles

    other:

    Article Title: Chromosomal instability promotes cell migration and invasion via EFEMP1 secretion into extracellular vesicles.
    Article Snippet: To create CRISPR knockout cell lines targeting the human STAT1 gene (details in Expanded View Table EV2), we utilized the pSpCas9(BB)-2A-Puro V2.0 (PX459) plasmid (Addgene plasmid 62988, Feng Zhang) (Ran et al, 2013).

    Article Title: Protocol for Using CRISPR-Cas9 to Generate a Monocyte Cell Line Harboring a Single-Nucleotide Polymorphism
    Article Snippet: BbsI (New England BioLabs, catalog number: R0539S) 3.

    Clone Assay:

    Article Title: A mutational scar-based genome-wide map of DNA double-strand break repair.
    Article Snippet: Plasmid pU6-(BbsI)_CBh-Cas9-T2A-mCherry was a gift from Ralf Kuehn (Addgene# 64324). .. SgRNA sequences were cloned into the pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W backbone, the pLentimulti-Guide backbone, or into the pU6-(BbsI)_CBh-Cas9-T2A-mCherry backbone using two custom complementary DNA oligos (IDT) consisting of the target sequence and BbsI overhangs, which were melted, annealed and ligated (Promega, Catalogue# M180B) into the relevant BbsI-digested (NEB, Catalogue# R3539S) plasmid backbone as described previously73. ..

    Sequencing:

    Article Title: A mutational scar-based genome-wide map of DNA double-strand break repair.
    Article Snippet: Plasmid pU6-(BbsI)_CBh-Cas9-T2A-mCherry was a gift from Ralf Kuehn (Addgene# 64324). .. SgRNA sequences were cloned into the pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W backbone, the pLentimulti-Guide backbone, or into the pU6-(BbsI)_CBh-Cas9-T2A-mCherry backbone using two custom complementary DNA oligos (IDT) consisting of the target sequence and BbsI overhangs, which were melted, annealed and ligated (Promega, Catalogue# M180B) into the relevant BbsI-digested (NEB, Catalogue# R3539S) plasmid backbone as described previously73. ..

    Plasmid Preparation:

    Article Title: A mutational scar-based genome-wide map of DNA double-strand break repair.
    Article Snippet: Plasmid pU6-(BbsI)_CBh-Cas9-T2A-mCherry was a gift from Ralf Kuehn (Addgene# 64324). .. SgRNA sequences were cloned into the pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W backbone, the pLentimulti-Guide backbone, or into the pU6-(BbsI)_CBh-Cas9-T2A-mCherry backbone using two custom complementary DNA oligos (IDT) consisting of the target sequence and BbsI overhangs, which were melted, annealed and ligated (Promega, Catalogue# M180B) into the relevant BbsI-digested (NEB, Catalogue# R3539S) plasmid backbone as described previously73. ..

    Article Title: Pool-packaged AAV libraries exhibit extensive length-dependent and homology-dependent chimerism.
    Article Snippet: .. Cloning complex libraries of doubly barcoded AAV constructs with various inserts To clone a set of doubly barcoded AAV constructs, we digested plasmid AiP11839 (Addgene, 163509) with PacI and BbsI (New England Biolabs) and size-selected the 2.9 kb backbone containing the AAV2 ITRs on agarose gel. ..

    Article Title: Salmonella effector SteE reprograms the macrophage regulatory network to drive specific hyperactivation of STAT3 target genes.
    Article Snippet: .. STAT1 and STAT3 gRNAs (Table S15) were designed using CHOPCHOP67 and inserted in px330-GFP plasmids using BbsI (NEB) digestion followed by ligation with Taq DNA ligase (NEB) according to the manufacturer’s instructions. iBMDMs were nucleofected with 2.5 ng of STAT1 or STAT3 gRNA-containing px330-GFP plasmid using Amaxa Mouse Macrophage Nucleofection Kit (Lonza) following manufacturer’s instructions. ..

    Synthesized:

    Article Title: Dual role of ZIC2 during neural induction: from priming transcription factor to enhancer activator
    Article Snippet: .. Complementary oligonucleotides containing BbsI (NEB, R0539L) overhangs were synthesized and annealed (see ) by heating to 95°C for 5 min, followed by gradual cooling down to 25°C at −5°C/min. .. Annealed oligos were ligated into BbsI-digested pX330A-hCas9-long-chimeric-gRNA-G2P vector using T4 DNA ligase (NEB, M0202L) and transformed into chemically competent E. coli (TOP10) via heat shock.

    Article Title: Dual role of ZIC2 during neural induction: from priming transcription factor to enhancer activator.
    Article Snippet: .. Complementary oligonucleotides containing BbsI (NEB, R0539L) overhangs were synthesized and annealed (see Supplementary Data 4 ) by heating to 95 ◦C for 5 min, followed by gradual cooling down to 25 ◦C at −5 ◦C/min. .. Annealed oligos were ligated into BbsI-digested pX330AhCas9-long-chimeric-gRNA-G2P vector using T4 DNA ligase (NEB, M0202L) and transformed into chemically competent E. coli (TOP10) via heat shock.

    Article Title: HDAC1 and SATB1 positively regulate immune responses in chicken macrophages
    Article Snippet: .. Corresponding single-guide oligos were synthesized, annealed, and ligated into BbsI (New England Biolads, #R3539) -digested, gel-purified pX459 vector. ..

    Cloning:

    Article Title: Pool-packaged AAV libraries exhibit extensive length-dependent and homology-dependent chimerism.
    Article Snippet: .. Cloning complex libraries of doubly barcoded AAV constructs with various inserts To clone a set of doubly barcoded AAV constructs, we digested plasmid AiP11839 (Addgene, 163509) with PacI and BbsI (New England Biolabs) and size-selected the 2.9 kb backbone containing the AAV2 ITRs on agarose gel. ..

    Bioprocessing:

    Article Title: Pool-packaged AAV libraries exhibit extensive length-dependent and homology-dependent chimerism.
    Article Snippet: .. Cloning complex libraries of doubly barcoded AAV constructs with various inserts To clone a set of doubly barcoded AAV constructs, we digested plasmid AiP11839 (Addgene, 163509) with PacI and BbsI (New England Biolabs) and size-selected the 2.9 kb backbone containing the AAV2 ITRs on agarose gel. ..

    Construct:

    Article Title: Pool-packaged AAV libraries exhibit extensive length-dependent and homology-dependent chimerism.
    Article Snippet: .. Cloning complex libraries of doubly barcoded AAV constructs with various inserts To clone a set of doubly barcoded AAV constructs, we digested plasmid AiP11839 (Addgene, 163509) with PacI and BbsI (New England Biolabs) and size-selected the 2.9 kb backbone containing the AAV2 ITRs on agarose gel. ..

    Agarose Gel Electrophoresis:

    Article Title: Pool-packaged AAV libraries exhibit extensive length-dependent and homology-dependent chimerism.
    Article Snippet: .. Cloning complex libraries of doubly barcoded AAV constructs with various inserts To clone a set of doubly barcoded AAV constructs, we digested plasmid AiP11839 (Addgene, 163509) with PacI and BbsI (New England Biolabs) and size-selected the 2.9 kb backbone containing the AAV2 ITRs on agarose gel. ..

    Ligation:

    Article Title: Salmonella effector SteE reprograms the macrophage regulatory network to drive specific hyperactivation of STAT3 target genes.
    Article Snippet: .. STAT1 and STAT3 gRNAs (Table S15) were designed using CHOPCHOP67 and inserted in px330-GFP plasmids using BbsI (NEB) digestion followed by ligation with Taq DNA ligase (NEB) according to the manufacturer’s instructions. iBMDMs were nucleofected with 2.5 ng of STAT1 or STAT3 gRNA-containing px330-GFP plasmid using Amaxa Mouse Macrophage Nucleofection Kit (Lonza) following manufacturer’s instructions. ..



    Similar Products

    98
    New England Biolabs restriction enzyme bbsi
    Restriction Enzyme Bbsi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bbsi/BbsI/pmc13095346-38-12-20
    Average 98 stars, based on 1 article reviews
    restriction enzyme bbsi - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    99
    New England Biolabs bbsi hf
    Bbsi Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bbsi/BbsI-HF/pm42129570-619-31-32
    Average 99 stars, based on 1 article reviews
    bbsi hf - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    98
    New England Biolabs bbsi
    Bbsi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bbsi/BbsI/pm42105764-217-16-17
    Average 98 stars, based on 1 article reviews
    bbsi - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    98
    New England Biolabs restriction enzymes bbsi
    Restriction Enzymes Bbsi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bbsi/BbsI/pm42107562-116-6-9
    Average 98 stars, based on 1 article reviews
    restriction enzymes bbsi - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    98
    New England Biolabs bbsi overhangs
    Bbsi Overhangs, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bbsi/BbsI/pm42103732-181-29-44
    Average 98 stars, based on 1 article reviews
    bbsi overhangs - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    99
    New England Biolabs r3539s t4 dna ligase neb
    R3539s T4 Dna Ligase Neb, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bbsi/BbsI-HF/pm42102812-772-151-155
    Average 99 stars, based on 1 article reviews
    r3539s t4 dna ligase neb - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    98
    New England Biolabs plasmid with bbsi
    Plasmid With Bbsi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bbsi/BbsI/pm42102812-811-6-9
    Average 98 stars, based on 1 article reviews
    plasmid with bbsi - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    99
    New England Biolabs tggttacaggagggctcggca reverse translated epitope
    Tggttacaggagggctcggca Reverse Translated Epitope, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bbsi/BbsI-HF/bio_rxiv__64898__2026__04__29__720676-150-13-18
    Average 99 stars, based on 1 article reviews
    tggttacaggagggctcggca reverse translated epitope - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results